Massachusetts Institute of Technology

The Broad Institute of MIT and Harvard

Software Engineer, Comp. Scientist, Computational Biologist & Grp. Leader

Apply your computing skills to DNA at MIT!

Have stellar computational skills, PhD or equivalent experience? Enjoy solving nearly impossible problems? We’ll retrain you to work with cutting-edge DNA technology!

We find biomedical applications for new DNA sequencing instruments yielding billions of short DNA sequences like
AATGTAATTTCAAATGTTAGCTCATTTTTGTTAATG

We need you on our team to solve the hard mathematical and computational challenges using terabytes of these data. We invent algorithms, delve deeply in the data, code like crazy, help design laboratory experiments: we do whatever is needed to make the new technologies fulfill their promise to unlock the mysteries of genomics and biomedical research in critical areas like cancer, human genetics, infectious disease, antibiotic discovery, genome evolution, man’s inhumanity to man, and the number 42.

We seek candidates from highly diverse backgrounds, industrial and academic. Mathematical and computational experience and excellence required, including superb C++ skills in a Linux or Unix environment. Biology training helpful but not required as you can learn on the job. Outstanding oral and written communication skills, joy in teamwork. A group leader position is also open for a candidate with proven leadership experience in computational science.

The Broad Institute of MIT and Harvard has an intense, exciting environment, world-class laboratory and computing facilities, hundreds of scientists tackling a wide range of critical problems in biology and medicine. Come join us!

Are you interested? If so, please send your resume and cover letter to:

Mark W. Rippa
322 Charles Street
Cambridge, MA 02141
mrippa@broad.mit.edu
(617) 324-9618

Applications should also be submitted through http://hrweb.mit.edu/staffing/.
Search for mit-00004694, mit-00004693, mit-00003916, and mit-00004577, Software Engineer, Computer Scientist, Computational Biologist, and Group Leader positions.

MIT is an equal opportunity/affirmative action employer. Applications from women, minorities, veterans, older workers, and individuals with disabilities are strongly encouraged.

The Broad Institute was founded to empower scientists of all kinds to work together on difficult, diverse, critical genomic and biomedical challenges. The Institute is a unique collaboration between the MIT and Harvard academic and medical communities, and it offers the resources and benefits provided to all MIT employees, including:

- Competitive pay
- Medical, dental, life insurance plans
- 401(k) plan with matching contributions
- Tuition assistance plan
- Four weeks of vacation after one year
- T-Pass subsidy program
- Athletic and fitness centers
- Child care services

Join a team that works the way you've always wanted to work.